Skip to main content

Table 2 List of primers used in PCR. See Methods section for details

From: Assessment of intestinal parasites in the coexisting Bombus terrestris (Apidae) and Xylocopa augusti (Apidae) in central Chile

Name Sequence (5′ → 3′) Target Expected amplicon size (BP) Reference
AbSSU-F GCGGTAATTCCAGCTCCAATA 18 rDNA gene, A. bombi 323 This work
NeoR GACAGCTTCCAATCTCTAGTCG   [23]
CbSSU-F TTAGGGTTCGATTCCGGAGAG 18 rDNA gene, C. bombi 477 This work
CbSSU-R CATGCGTGGATCAGGAAAGGA   This work
NbSSU-F TGAGGTGATTAATTGGAGGGC 18 rDNA gene, N. bombi 404 This work
NbSSU-R CTCCTTGTGGTATTCTTCCGT   This work
BT-F AGGATTAGACGTTGATACACGAGC Mitochondrial genome, B. terrestris 447 This work
BT-R GGATAATCTGAGTATCGTCGAG   This work
XA-F TCCAATAGGAGGAGGAGATC COI gene, X. augusti 657 This work
XA-R CGTCGAGGTATTCCTATCAATCC   This work